jwkalfas jwkalfas
  • 23-08-2021
  • Mathematics
contestada

Where would you find the point (-10,0)

Respuesta :

Chrisbosse5
Chrisbosse5 Chrisbosse5
  • 23-08-2021
You would find this point at -10 on the left side of the x-axis relative to the origin.
Answer Link

Otras preguntas

Use the function f(x) = 3x - 1 to answer question 1-34. Match the solutions to the questions. Column A 1. f(14) = ?: f(14) = ? 2. f(-10) = ?: f(-10) = ? 3. f(x)
a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
Decide if the information below demonstrates effective note-taking and choose the best choice from the drop-down menu. Native American< 5% of the population
Brainliest!!!! Three functions are shown in the table on the left. Complete the sentences comparing the three functions. ___ has the greatesst maximum (f(x), g(
simplify (7xy)^2 ????
-16 - 17= ? I need help with this question
What is the least integer value in the solution set to 7(3x – 1) ≤ 4x? –1 2 3 7
Bhhbbhhhhhhcddddssdddddddddxxx
In 2018, the state of Tennessee executed Billy Ray Irick using a lethal injection cocktail that some experts said was tantamount to torture and had been implica
-3/8x - 20 + 2x is greater than 6