montgomerybunston montgomerybunston

22-09-2020
Biology

contestada

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Respuesta :

oceanbluewater3000 oceanbluewater3000

22-09-2020

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

Answer Link

Otras preguntas

how many feet are in 108 inches?

John finds that he can make 34 cookies from a single batch of a recipe. If he makes six batche, how many cookies can he make?

Where is the Mediterranean Sea? A.northwest of the Arabian Peninsula B.southeast of the Arabian Peninsula C.northeast of the Arabian Peninsula D.southwest of th

Each bag of potatoes weighs 5 3/4 pounds.How many pounds would 2 1/2 bags of potatoes weigh?

what is 20 divided by 12

The longest side of the right triangle is 2 feet more than the middle side and the middle side is 1 foot less than twice the shortest side. Find the length of t

7(2x+6)-4(9x+6)<-26 what is the answer ?

Mariah subtracted 2/7 from 10/9. She founda difference of 4. What mistake did she make, and how can you correct it to find the right answer.

If 4^x+1 = 64, then what is the value of x^4

During the first three Presidential elections the President and the Vice-President were chosen by: Congress Republicans electoral college their peers