croitru7857 croitru7857
  • 25-02-2018
  • Biology
contestada

The base sequence of the template strand of dna is cattggtaggcaaaagaact. what is the new synthesized complementary strand?

Respuesta :

Eric0422 Eric0422
  • 25-02-2018
gtaaccatccgttttcttga
Answer Link

Otras preguntas

Help with mathematics
help me please ? Find the missing length indicated. A) 48 B) 36 C) 100 D) 64
Why do people grow hair?​
20000/1 × 7/15000× 1/56
capitalism is an economic system in which all property is shared among people true or false
Which of the following best describes a toolbar? A. displays frequently used menu options B. displays formatting commands C. displays the document name D. displ
welp! Tysm!!!! Each marble bag sold by Justin's Marble Company contains 4 purple marbles for every 5 red marbles. If a bag has 20 purple marbles, how many red
Evaluate 12sigma n=3 -5n-1
If 3 is added to twice a number, the result is 17. Find the number
The figure shows the front side of a metal desk in the shape of a trapezoid. What is the area of this trapezoid? 10 ft² 16 ft² 32 ft² 61 ft² Isosceles tra