knockoffc knockoffc

26-01-2018
Spanish

contestada

Ful a Jamaica ___ dos meses.

A. hizo
B. hace
C. haga
D. hacia

Respuesta :

leticiask15 leticiask15

26-01-2018

B. hace dos meses
two months ago

Answer Link

christopherfilp christopherfilp

26-01-2018

la b fui a jamaica hace dos meses

Answer Link

Otras preguntas

To what other kind of "The Leap" might the title refer?

Mitosis and meiosis are similar processes. Which BEST describes what can only occur after meiosis? A.Parent cells can be either haploid or diploid. B.Products o

14. Higher Order Thinking Does Cavalieri's Principle apply to the volumes of the cones shown? Explain

The adjacent sides are perpendicular.

Please complete the following DNA strands 1. AGGTCCAAGCTCAAATTTCCCC 2. GAAACCCCTTAAACCTTAATTCC 3. GCGCGCGCAAATTTTTCCCATCT Please complete the following strands

PLEASE HELP Ms. Bennett has $47 in her wallet. She buys 3 hotdogs for her children and now has $36.50 left in her wallet. Write and solve an equation to find th

What is used to prevent all vlans from going across a trunk?

Solve each system of equations. a. x+y=-4 y= - x+5 b. y= - 2x+5 2x+y=5

Mireille is describing her classmates and teacher in French class. Complete her statements with the appropriate adjective as indicated.

PLEASE HELP! DUE TONIGHT