epicbob2004 epicbob2004

21-11-2017
Mathematics

contestada

Please can someone help me in struggling
Estimate the value of 98.5*13

Respuesta :

jadavma2004ovikpd jadavma2004ovikpd

21-11-2017

98.5 x 13 = 1280.5
Round it to 1281

Answer Link

skygoller21 skygoller21

21-11-2017

1281 is the rounded answer of the value of 98.5*13

Answer Link

Otras preguntas

If you saw this strand of DNA how many base pairs would be in thestrand?aagcttctgaatcagttcgaagacttagtc

PART A: Use the following glycolytic reaction to answer the question. If the concentration of DHAP is 0.125 M and the concentration of G3P is 0.06 M in a cell,

Bob and Rob have started a food delivery business together called Grub Galore in their college town. They have not incorporated their business and they run it f

A rotating fan completes 1200 revolutions every minute. Consider the tip of a blade, at a radius of 0.15 m. (a) Through what distance does the tip move in one r

how does proctor get power in the crucible

one ninth is what percent?

Which of the following attributes of oxygenated blood makes functional MRI (fMRI) possible? A. It can be seen using x-rays. B. Active areas of the brain take u

When conducting research with Spanish-speaking participants, it is often necessary to first provide a description of the study purpose in Spanish. What ethical

Solve the inequality -2/11j<8

A thermocouple, with a spherical junction diameter of 0.5 mm, is used for measuring the temperature of hot airflow in a circular duct. The convection heat trans