ghpri2ckcarpear1lacn ghpri2ckcarpear1lacn
  • 24-03-2017
  • Biology
contestada

Which are the first organisms to start the process of primary succession?

Respuesta :

tajina tajina
  • 25-03-2017
they are called microorganisms
Answer Link

Otras preguntas

what are the chromosome numbers of daughter cells in mitosis and meiosis
E. coli (K12) has a genome size of 4,639,675 bp in one chromosome that encodes for 4,435 proteins. The average size of these proteins is 330 amino acids. What p
Write a recursive function for this sequence 8,12,18,27..
Discuss the consequences of poor wound management.
what are examples of processing large data using web technologies
Translate these lines from the poem. "Bot wold ye, lady louely, then leue me grante Nay, for sothe, beau sir, sayd that swete" WOW, I'M LOST!! #ihatemyenglishc
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
f(x)= 3/x+2-square root x-3
What is 7 3/4 times 7?
what number must you add to the polynomial below to complete the square? x^2-x A. 1/4 B. 1/2 C. 2 D. 1