hydebrinden hydebrinden
  • 25-05-2022
  • Biology
contestada

what two states have different Latitude Temperature?​

Respuesta :

srichards743
srichards743 srichards743
  • 25-05-2022

Answer:

Places at the same latitude may have very different climates if one is on a coast and one is inland. On the coast, the climate is influenced by warm moist air from the ocean.

Explanation:

A coastal climate is usually mild. Summers aren't too hot, and winters aren't too cold

Answer Link

Otras preguntas

A 15.6 grams of ethanol absorb 868 J as it is heated. The initial temperature is 21.5 degrees Celsius. What is the final temperature if the specific heat of eth
The shift from agriculture to industrialization illustrates that __________. A. land has become scarce B. economies change over time C. society has become more
why does a virus stay in a person for life, such as hepatitis
Help me factor 5x^2-22x-15
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
I need help with this. thank you!
. If a human has not eaten in 6 days,
1. Obligate anaerobes are often grown in an anaerobe jar, which completely excludes oxygen from the environment. How is the environment within a tube of fluid t
(Does this represent a linear function) (3,6)(0,2)(3,5)
how to solve these question?