dgonzalez20001 dgonzalez20001
  • 26-01-2015
  • Mathematics
contestada

a=c+(-10) Solve for c in terms of other variables.

Respuesta :

mathwiz35 mathwiz35
  • 26-01-2015
to do this we need to move 10 to other side.  To accomplish this you just need to add 10 to both side since (-10) 

so 
A+ 10 = c -10 + 10 
we get
A+ 10 = c

lets say it wasn't -10 but positive 10. 

A = c + 10  then we would subtract 10 from both sides

A -10 = c + 10 - 10 
we get 
A  - 10 = C 
Answer Link

Otras preguntas

Alejandro looked at his first three science test for the quarter.His scores are represented i different ways Test one:21 question right 25 total of question wh
Devin will equally divide 23 tablespoon of oregano into 4 spice mixes. How much oregano will he put in each of the 4 spice mixes?
A B C D Ty!!!1!!!!!!!!!!!!!!!!
The three major West African empires increased their wealth by
DNA tacaggtacccgaacccaattta
Study the pattern above. Which type of transformation is displayed within the pattern? A) reflection B) translation C) rotation D) transfer
WILL MARK BRAINLIEST PLEASE HELP !!! What is the equation of the line in standard form? A. x + 3y =5 B. 5x + 3y = 1 C. 3x + 5y = 1 D. x + 5y = 3
5+2×=2×+6 what is the answer
Scientist use data from Gregor Mendel‘s studies to conclude that information about traits is passed from parents to offspring through
Please help! Limits. Just confirm that an coverages to 2 as n-->infinity