gnguyen3070 gnguyen3070

25-03-2022
Social Studies

contestada

What are three circumstances that might increase the risk of a young person joining a gang?.

Respuesta :

koldenburg09 koldenburg09

25-03-2022

Answer:

Parent-child separation, Academic failure, Peer gang membership, Poverty.

Explanation:

Hope this helps a little have a nice day.

Answer Link

Otras preguntas

Hydrogen peroxide decomposes to give water and oxygen gas according to the equation below. If 3.0 moles of hydrogen peroxide decompose, what volume of oxygen ga

A department store purchases a dress for $80. To sell the dress to customers, the price is marked up by 19%. You hand the clerk $110. How much change will you

What are the adaptive immune responses induced following acute and chronic infection with HIV?

What is a vestigial organ

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

1. Obligate anaerobes are often grown in an anaerobe jar, which completely excludes oxygen from the environment. How is the environment within a tube of fluid t

What shape have at least 2 parallel sides

specificity is important to fitness program because it

As the Civil War drew to a conclusion, the chief concern of Republicans in Congress was that

Hydrogen peroxide decomposes to give water and oxygen gas according to the equation below. If 3.0 moles of hydrogen peroxide decompose, what volume of oxygen ga