dantwonpatterson dantwonpatterson

24-03-2022
Mathematics

contestada

A 12-foot ladder is placed
against a house. The base of the
ladder is 9 feet from the house.
How high up the house does the
ladder reach?

Respuesta :

Аноним Аноним

24-03-2022

Answer:

7.94 ft to nearest hundredth.

Step-by-step explanation:

By Pythagoras:

h^2 = 12^2 - 9^2

h^2 = 63

h = 7.94 ft.

Answer Link

Otras preguntas

Comet is seen after a long period of time. Why?

A cube is a rectangular prism with the same measurement for length, width and height. if a cube is 4 inches tall, what is its volume?

A pair of equal charges are separated by .75 m. There's a 2500 N force acting on them. What is the strength of the charge? Plz explain how you got the answer to

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT

is there any other ones that are mathematical sentences ?

Based on the section "The power of nature," why is rainfall in the south important to all of China?

Someone plz help 50 points and brainliest if correct!!!

What is the value of b in the equation.....

A student used a yardstick to model displacement of a rock at a fault during an earthquake

1.Maya ____washed the dishes that her brother had left inthe sink.2. The bicyclist was ____with her bright yellow reflectors.3. The mayor arrived ____in a long