bribri61500 bribri61500

25-02-2022
Mathematics

contestada

cylinder with a radius of 2in and a height of 8in.

Respuesta :

40122688 40122688

25-02-2022

Answer:

125.66in²

Step-by-step explanation:

A=2πrh+2πr2=2·π·2·8+2·π·22≈125.66371in²

Answer Link

Otras preguntas

Can you help me explain

During the late 1800’s what was the main reason so many immigrants came to the United States A. Religious Freedom B. Opportunities for jobs C. Escape from war

Passage A—An excerpt from Katherine Johnson's autobiography I remember it like it was yesterday. Everyone was so nervous. John Glenn and his crew would be the f

Ava and Mary are 10 miles apart on a path when they start moving toward each other. Ava runs at a constant speed of 4 miles per hour, while Mary walks at a cons

If the car backing out was initially 55 m in front of you, what is the maximum reaction time you can have before hitting the brakes and still avoid hitting the

What are the steps to convert a number from standard notation to scientific notation?

1/2 x 3 x 7 1/4 for my test

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

How does your body respond to an increase in the waste products of energy production

Which cut on the evolutionary tree would create a clade? A, B, C, D (See photo for example)