8231609 8231609
  • 26-05-2021
  • History
contestada

What tradition was started by Mehmed II

Respuesta :

41896
41896 41896
  • 26-05-2021

Answer:

In order to repopulate the city, he deported Muslim and Christian groups in Anatolia and the Balkans and forced them to settle in Constantinople. He restored the Greek Orthodox  (January 6, 1454) and established a Jewish grand rabbi and an Armenian Apostolic (Orthodox)  in the city.

Explanation:

Hope it helps!

Answer Link

Otras preguntas

blank thousands equals 1800 tens
1+4 = 5. 2+5=12. 3+6=21 8+11==?
What name was given to the Allied plan to invade France?
analyze how heat transfer occurs during the processes of conduction and convection.
Do any of these represent a linear function (just state letters if they do)
During a cesarean section, an incision is made through all EXCEPT which of the following? A)linea alba B)perimetrium C)superficial fascia D)decidua basalis
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
The answer to 5+5×5+5=
As the Civil War drew to a conclusion, the chief concern of Republicans in Congress was that
A cubic centimeter holds 1 milliliter of liquid. How many liters of water to the nearest tenth are required to fill a fish tank that is 24 centimeters high, 28