alixha25 alixha25
  • 25-05-2021
  • Physics
contestada

It’s IT but I really need the answer

Its IT but I really need the answer class=

Respuesta :

ralphnikey
ralphnikey ralphnikey
  • 25-05-2021

The answer to the question is logic

Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Which verb form correctly completes the sentence? Is the verb singular or plural? The boy with the red shirt and blue jeans __________ been his friend since h
how to solve these questions?
blank thousands equals 1800 tens
Which of the following tactics do food manufacturers use to try to get you to buy their products? a. TV and radio commercials b. all of the above c. coupons d.
find the amount of the discount on a $234 item with a discount of 15% A. $35.01 B. $40.00 C. $23.40 D. $35.10
what is 7/8ths of 40
Imagine a situation in which the number of urea leak channels increased dramatically in the ascending limb of the loop of Henle. What could be one likely conseq
which of the following are solutions to the equation below? check all that apply. x^2+6x+9=6 A. x=3+√6 B. x=3-√6 C. x=3 D. x=0 E. x=-3+√6 F. x= -3-√6
What's 165% as a fraction and decimal