Jordanroy33313 Jordanroy33313
  • 22-05-2021
  • Mathematics
contestada

Plz help will mark brainliest :)

Plz help will mark brainliest class=

Respuesta :

hr92425
hr92425 hr92425
  • 22-05-2021

Answer: 6

Step-by-step explanation:

[tex]-5x+\frac{8x}{4}[/tex]

[tex]-5(-2)+\frac{8(-2)}{4}[/tex]

[tex]10+\frac{-16}{4}[/tex]

[tex]10-4[/tex]

= 6

Answer Link
brandyharris13 brandyharris13
  • 22-05-2021
The answer is going to be 6
Answer Link

Otras preguntas

Consider the combustion of octane (C8H18) 2C8H18+25O2-> 16CO2+18H2O How many grams of CO2 are produced when 191.6g of octane are burned?
what finger does the ring go on
The gradient of a stream depends on its
how can a driver best be prepare to enter sharp curves
how many branches of government are dictated in the us constitution,what are those branches??
if an element has more than one ionic change how is that piece of information represented in the chemical name
A red dwarf is _____ A. the remains of a supernova. B. a hot pulsar. C
Compare and contrast immune tolerance with licensing
If 1+4=5; 2+5=12; 3+6==21; what is 8+11
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC