joeydean5 joeydean5

21-05-2021
Mathematics

contestada

Find the solution of the system of equations.
–7x – 3y = –20
3х + 6= -15

Respuesta :

azocher26 azocher26

21-05-2021

Answer:

(-7,23)

Step-by-step explanation:

You can use the app photo math

Answer Link

Otras preguntas

A number tripled and tripled again is 729 what is the number

What is the significance of the similar number and arrangement of bones in a human arm and a bat wing?

7- What types of RNA are present in a cell and how can you selectively make copies of only the mRNAs?

what process releases the least atp per molecule of glucose for immediate cell use?

Suggest a reason why food labels provide information about the energy released by the food?

During the 1800s, the nations supply of currency was tied to its national reserves of either gold or silver. In 1900, an act was passed by congress that would s

Consider the combustion of octane (C8H18) 2C8H18+25O2-> 16CO2+18H2O How many grams of CO2 are produced when 191.6g of octane are burned?

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

. Green swordtails are sexually dimorphic: males have a long, swordlike projection from their tails, and females have rounded tails. An experimenter decides to

Sound travels at a rate of 340 m/s in all directions through air. Matt rings a very loud bell at one location, and Steve hears it some time later at his locatio