xo8xourseszaz5 xo8xourseszaz5
  • 25-11-2016
  • Mathematics
contestada

a cirque is what shape?

Respuesta :

ktrav258
ktrav258 ktrav258
  • 25-11-2016
I think it's a circle

Answer Link

Otras preguntas

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
To figure out what type of tests you are best at, you should a. Ask your teacher for their professional C. Ask more questions in class opinion b. Write down you
A 1.5 kg block is connected by a rope across a 50-cm-diameter, 2.0 kg , pulley that spins on a frictionless axle, as shown in (Figure 1). A constant 10 N tensio
a house purchased for $226,000 has lost 4% of its value each year for the past five years. What is it worth now
If g is the inverse of the function f(x) = sqrt(x - 6) - 10 , which of the following is g?
Historians believe that the Harappa and Mohenjo-Daro were organized societies. They had strong _______________ (14) because of their construction. Buildings wer
Mr. Mogi borrowed $9000 for 10 years to make home improvements. If he repaid a total of $20,000 at what interest rate did he borrow the money?.
When was the child abuse and neglect reporting act passed.
how metallic minerals have been formed. Which types of rocks are they found in, and why
According to weather theory, what time of year is MOST likely to see an increase in shootings?