giaeliasieponga giaeliasieponga

24-11-2016
Social Studies

contestada

9 of 25
The Federalists were more accepting of the Articles of Confederation than the anti-Federalists.

True

False

Respuesta :

pkmnmushy pkmnmushy

24-11-2016

Actually is False. The anti-federalists had more support over the articles of confederation. They wanted to make some changes, but not get rid of it completely. I hope this is a good help for you

Answer Link

Otras preguntas

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

Using the formula below, calculate the kinetic energy of the 6 gram stone going 10 Mph going 10 mph KE = 1/2 Mass x Speed? =

is farmland land or capital and I need a answer asap

.....................................................

For a project in her Geometry class, Makayla uses a mirror on the ground to measure the height of her school building. She walks a distance of 13.75 meters from

Do you think political parties are a good idea?

please help me on this question plizzźzzwhat is the green colouring matter found in plants called

Help me pls you will get brainliest

Summary abt romeo and juliet act 1

cyber ethics and law are same in nature true or false