Ca3ceplydgrahnicb6ai Ca3ceplydgrahnicb6ai

21-11-2016
Mathematics

contestada

Write a polynomial function to the least degree with these roots 2 &3i ...?

Respuesta :

alsteva alsteva

24-11-2016

[tex]P(x)=(x-2)(x-3i)
\\
\\P(x)=x^2-3ix-2x+6i
\\
\\P(x)=x^2-x(3i+2)+6i[/tex]

Answer Link

Otras preguntas

A park has a large circle painted in the middle of the playground area.thecircle is divided into 4 equal sections And each section is painted a different color.

The Democratic split was so severe during the 1860 elections that _____.

What is the energy transformation that is taking place from the batteries to the flashlight when it is on? A) heat to magnetic to light B) chemical to magnetic

What was the original element formed moments after the Big Bang? What then created higher order elements?

The diameter of a circle is 16 miles. What is the circle’s area? Use 3.14

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

how many ways can you arange the letters in the word cube

A solution of baking soda and water has a pH of 8.40. What type of solution is this? 1. acidic 2. neutral 3. basic

The fundamental cause of MOST of India's current environmental problems can be linked to A) soil erosion. B) monsoon floods. C) overpopulation. D)

Figure 1 is dilated to get Figure 2. What is the scale factor? Enter your answer, in simplest form, in the chat.