tanyasingh21
tanyasingh21 tanyasingh21
  • 26-03-2021
  • Biology
contestada

Help me plz asap 2-4 plz

Help me plz asap 24 plz class=

Respuesta :

annaclaire946
annaclaire946 annaclaire946
  • 26-03-2021

Answer:

1.mRNA- ATGAAAAGGTCCGTGGGAACTAAACAACACTAA

2.MRNA- ATGAAAACGGTCCGTGGGAACTAAACAACACTAA

3. ??

4. It will affect the protein so the leg wont have enough protein or have too much.

Explanation:

Answer Link

Otras preguntas

Write an inequality to model the situation: The number n of people who applied for the job was at least 6.
A student has a 2% salt water solution and a 7% salt water solution. To best imitate salt water at a local beach, he needs 1 liter of a 3.5% salt water solution
What are the missing angles measures in a circle with 90 degrees and 114 degrees
Describe why the vice president in a company makes a very high salary
Given the system of equations, match the following items. x + 3 y = 5 x - 3 y = -1
how do you fill out a 4 square code for a paragraph
I need help on this so I can write a 2-3 paragraph essay The Bankers Putsch (or Bankers Plot or Wall Street Putsch) is an illustration of how FDR was straddling
Who wrote the communist manifesto with karl marx? a. friedrich engels b. john stuart mill c. david ricardo d. robert owen
NO FAKE ANSWERS OR ELSE I WILL REPORT What is the average temperature or range of temperature in a desert?
Fantasy Lanes bowling alley charges each patron $3 to rent shoes plus $5 per hour for bowling. This relationship is represented by the equation y = 5x + 3. Wha