aromalprasadpillai06 aromalprasadpillai06

23-02-2021
Mathematics

contestada

please help
what area of a rhombus

Respuesta :

JoshuaWeaver2020 JoshuaWeaver2020

23-02-2021

Area=pq/2

Where p and a are diagonals of the rhombus

Answer Link

Otras preguntas

Rather than describing the increased kinetic energy of the stone to the work of gravity, we now (when using potential energy rather than work-energy) say that t

A huge variety of networking hardware and software appeared. One challenge was to enable these different networks to communicate with each other. ARPA accomplis

Which of the following attributes of oxygenated blood makes functional MRI (fMRI) possible? A. It can be seen using x-rays. B. Active areas of the brain take u

What was the Sussex pledge? A) an agreement between Germany and Serbia where Germany would give Serbia $2.2 million dollars for the assassination of the Ar

Which of the following functions is graphed below? HHHHHHHH O A. y = |x + 2|-3 O B. y = |x + 2| +3 O C. y = |x - 2|-3 O D. y = |x - 2|+3

The main difference between a nuclear power plant and other kinds of power plants is

If you saw this strand of DNA how many base pairs would be in thestrand?aagcttctgaatcagttcgaagacttagtc

The appendix is discussed in a digestive system chapter because it is located near the junction of the small and large intestines. However, it does not have any

Which figure can be formed from the net? An unfolded triangular-based pyramid with a base-side measurement of 9 ft. The length from the base to the tip of a tr

Gibbons, small Asian apes, move by brachiation, swinging below a handhold to move forward to thenext handhold. A 9.3kggibbon has an arm length (hand to shoulder