vlonelyscloud vlonelyscloud

22-02-2021
Mathematics

contestada

Help me with this thanks!

Help me with this thanks class=

Respuesta :

Anynonmous12 Anynonmous12

22-02-2021

Answer:

C

Step-by-step explanation:

C is the only one that isn't increasing or decreasing

brainliest?

Answer Link

Otras preguntas

Though mercantilism limited trade during the Age of Exploration, European economies grew rapidly during this period, largely because of? A. The natural resourc

please guys......................

When infants attempt to imitate an adult's action (e.g., smile, hand clapping, sound), they are less likely to mature into unique individuals. True False

The graph shows the number of laps kailee ran around a track over a given number of minutes.(a) What is the slope of the line? Use the slope formula and show yo

Help word problem math

how do you find the voltage of a parallel circuit.

Identify the sentence that contains a misplaced or dangling modifier. A. After counting the ballots several times, the Election Commission sent the results to

DNA tacaggtacccgaacccaattta

Factor the expression completely over the complex numbers. y^4+24y^2+144

Sean chewed 2/5 of his rawhide bones. If he had 10 bones to begin with, how many did he chew up?