Mroman6 Mroman6

26-01-2021
Physics

contestada

If you push or pull an object,the object gains energy. True or False

Respuesta :

DeadbeforeLife DeadbeforeLife

26-01-2021

Answer:

True

its giving an object that has potential energy, kinetic energy.

Explanation:

Answer Link

Otras preguntas

On a client/server network, which computer initiates the process of assigning an IP address through DHCP? 1) The DHCP server 2) The client 3) The gateway 4) The

15 multiplied by 9.6

match the the term /word in colounm a

Place the paraphrases in the correct logical order to a summary. Submit Test 今 et. The narrator says he is afraid to go but is excited at the same time. e ท. e

In the standard system, bolts, studs, and nuts are measured in _________. Question 6Select one: a. Threads per centimeter b. Threads per inch c. Threads per

Two nearby trumpets are sounded together and a beat frequency of 5 Hz is heard. If one of the trumpets sounds at a frequency of 501 Hz, What are the two possibl

How often must you renew your FAFSA? a. Each semester b. Each academic year c. Every five years d. Every ten years

What was "The Bridge"?

Codons Which amino acids does this mRNA strand code for? *You must spell out the entire name of the amino acid* 5'CCGGAUGUCCGUAUAACGGC3'

What is the role of the Device Controller Interface (DCI) in a computer system?