26-01-2021
Chemistry

contestada

What happens when air absorbs more water

Respuesta :

Riley5800 Riley5800

26-01-2021

Answer:

when air absorbs more water, the air is more damp and humid. It can also cause fog.

Explanation:

Answer Link

Otras preguntas

2. Students are asked to sequence the order of the seasons using picture cards. Which group of students sequenced their picture cards correctly? winter summer s

Discuss the consequences of poor wound management.

Pseudomonas syringae is found naturally in the soil. Sold as Snomax, it is used to make snow at ski resorts. The same bacterium with a gene deletion (Ice-minus)

what mass of iron 3 chloride contain 2.35 x 10 to the 23rd chloride ions

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Pseudomonas syringae is found naturally in the soil. Sold as Snomax, it is used to make snow at ski resorts. The same bacterium with a gene deletion (Ice-minus)

what is the credit card balance? A-The amount of interest you must pay the credit card company. B-The required minimum payment to your credit card company. C-A

the volume of a sphere is 950 cubic inches. Use the formula for the volume of a sphere to find the radius to the nearest tenth of an inch

I only need to know the answers to numbers 9 and 10 The problems are the ones circled in the photo

Identify the parts of the human body that normally contain bacteria