milkshake13 milkshake13

25-01-2021
Arts

contestada

Look here and become brainliest! I will give you brainliest if you tell me what you think about it!

Look here and become brainliest I will give you brainliest if you tell me what you think about it class=

Respuesta :

s28043891 s28043891

25-01-2021

Answer:

SO GREAT O_O

You should make a manga series

infinity claps for you

Answer Link

Otras preguntas

How can 65% be broken down with friendly percents to find 65% of a number?

. (MC) Which tactic was used by both the United Farm Workers and the Southern Christian Leadership Conference to achieve change? (1 point) lunch counter sit-in

This poster was used during the administration of president woodrow wilson to:

New York’s finger lakes were formed by the same process of the Great Lakes what was this process

A science journal published a report which states that the solar activity has increased in the last two years. Which of the following events is most likely an e

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

On a visit to his mother's home, steve's mother introduced him to her new next-door neighbor. after chatting with the neighbor for a few minutes, steve realized

Fish populations and other aquatic resources are likely to be affected by changes in what aquatic factors? (Site 2)

Fill in the blank with the verb that best completes the sentence. Marcos _____ años en septiembre.

I’m what way did British leaders misunderstand the revolutionary war