banksoliviag banksoliviag
  • 23-01-2021
  • Mathematics
contestada

rewrite sin^2 2xcos ^2 2x as an expression in terms of the first power of cosine

Respuesta :

18samra5553
18samra5553 18samra5553
  • 23-01-2021

Answer:

Step-by-step explanation:

use the formula { a couple of times} cos 2 Θ = 2 cos ² Θ - 1 = 1 - 2 sin ² Θ....your answer will likely have a cos  2x , a cos 4x , and a cos 6x in it.....note : cos ² Θ - sin ²Φ = cos ( Θ + Φ) cos (Θ - Φ) will also be needed for appropriate choices of Θ & Φ in terms of x

Answer Link

Otras preguntas

All of the countries in Southern Africa are classified as _____.
which of these fractions represent 35% 35/10 1/35 100/35 or 35/100
Much research has been done in the cloning of animals; a tadpole in 1954, Dolly the sheep in 1997, and the endangered gaur are just a few of the "famous” cloned
How is an art historian’s job different from an art critic’s job
Which of these best desrcibes the harlem renaisscane
length = 125 cm, height = 28cm, Volume = 21000cm^3. Find breadth of a cuboid.
How do astronauts overcome this obstacle when communicating in space? 3HYETGGTETFEETEETETETETETETTETETEET
Please complete the following DNA strands 1. AGGTCCAAGCTCAAATTTCCCC 2. GAAACCCCTTAAACCTTAATTCC 3. GCGCGCGCAAATTTTTCCCATCT Please complete the following strands
is 5+ sqrt(19) rational or irrational?
can someone answer this for me ill give brainliest if its correct