ellavontran
ellavontran ellavontran
  • 23-12-2020
  • History
contestada

Federalist wanted to avoid problems like....

Federalist wanted to avoid problems like class=

Respuesta :

Аноним Аноним
  • 23-12-2020

Answer:

Federalist wanted to avoid Government Taxes

Explanation:

Answer Link

Otras preguntas

Suggest a reason why food labels provide information about the energy released by the food?
Pythagorean Theorem: Alex leaves home, travels 5 miles east, and arrives at the library. He leaves the library and travels 3 miles north to a friend's house.
1. The chart below shows changes in the length of a tree's shadow during a sunny day. (5.2.D) LENGTH 8:00 AM 2 meters 9:00 A.M. 1 meter 10:00 A.M. 0.5 meter 12:
The radius of the planent venus is nearly the same as that of the earth,but its mass is only eighty percent that of the earth. If an object weighs w on the eart
what would you use chromatography for?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
how was sam houston passionate? give atleast 2 examples with explanation
when addressing an envelope for delivery in the united states or canada, the zip code should appear where
:Select the correct text in the passage .Which lines in this excerpt from Phillis Wheatley's poem "Goliath of Gath" contain examples of figurative language? The
Compared to mitosis, meiosis results in greater... A)amount of cell cytoplasm per cell B)number of daughter cells per cell C)amount of genetic material per cell