bojjasoujanyareddy
bojjasoujanyareddy bojjasoujanyareddy
  • 24-11-2020
  • Mathematics
contestada

a) Convert 40° C to °F​

Respuesta :

averyrichardsson
averyrichardsson averyrichardsson
  • 24-11-2020
the formula is F= (c x 9/5) +32, so if you plug it in you get F= (40 x 9/5) +32. You are solving for F. The answer to the equation is F=104 degrees Fahrenheit
Answer Link

Otras preguntas

Match each characteristic to the correct philosopher.
Please help me which are the ones that are correct?
What kind of law follows precedent based on past rulings of judges? a. Civil law c. Criminal law b. Common law d. Legal law
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid
Can someone help me? It's urgent and thank you!
The formula for the volume of a cylinder is Y = gr). Solve y = grn for h, the height of the cylinder. O A. = O B. has Yr2 OC. h - TV O D. h =PLEASE HELP ASAPPPP
Bank ABC has checkable deposits of $415 million and total reserves of $50 million. The required reserve ratio is 9 percent. The bank has excess reserves of Grou
math help please 2 questions
A uniform copper wire has a resistance of 100 ohms. If the wire is cut into 10 equal lengths, what will be the resistance of each piece
SOMEONE, PLEASE HELP!!!!!!