Koreyparham827 Koreyparham827

22-09-2020
History

contestada

What has decreased the exports of Angola?
Odrought
civil war
the
corruption
famine

Respuesta :

Аноним Аноним

22-09-2020

Corruption in Angola has decreased its exports.

Answer Link

Otras preguntas

2. Students are asked to sequence the order of the seasons using picture cards. Which group of students sequenced their picture cards correctly? winter summer s

what is the property of 6x=72

Mrs. Toomer brought 40 cookies to school. Mrs. Toomer's class ate 1/2 the cookies. Mrs. Wilson's class ate 1/4 of the remaining cookie. How many cookies are

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

A patient comes into the clinic with a resting heart rate of 80 beats per minute (bpm). The patient's cardiac output was found to be 5.6 liters/minute with an e

Sam left his school at 3:05. He walked at a speed of 3.2 mph. 15 minutes later, Al started running after him, and he caught up with Sam 10 minutes later. What w

Which of the following ideas best fits with biological evolution by natural selection? 1.The most fit individuals are those with the highest reproductive succes

if an element has more than one ionic change how is that piece of information represented in the chemical name

Make a word rearranging the following letters: C O P E S O R I M M

in a beauty contest, half of the judges voted for miss.a .2\3 of them voted for miss.b., 10 voted for both and 6 did not vote for either miss.a or miss.b.find h