futurqrtbck futurqrtbck
  • 21-09-2020
  • Mathematics
contestada

Which trigonometric expressions equal - 1/2? Check all that apply.

Respuesta :

marietriston
marietriston marietriston
  • 24-09-2020

Answer: A: cos(120)

B: sin(7pie/6)

E: cos(-10pie/3)

Step-by-step explanation:

Answer Link
AlanoQui AlanoQui
  • 23-12-2020

Answer:

A

B

E

Step-by-step explanation:

Edg 2020

Answer Link

Otras preguntas

The heart sounds S1 and S2 are...?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
how are the four earths systems connected
If someone was born with Jacob’s syndrome (XYY), in which parent and when nondisjunction happened during gamete formation?
Why would Congress not seat newly elected senators and representatives from southern states?
Why it is not possible to draw a square that is not a parallelogram
what Is the difference between organic and inorganic matter?
Please help me answer these questions
approximately how long does it take the moon to complete one orbit around earth
Pseudomonas syringae is found naturally in the soil. Sold as Snomax, it is used to make snow at ski resorts. The same bacterium with a gene deletion (Ice-minus)