TheLawless09 TheLawless09

24-08-2020
Mathematics

contestada

What is the value of the expression? 3 x [(30 - 8) divided by 2 + 2]

Respuesta :

worthyyy worthyyy

24-08-2020

Answer:

3×30=90

3×8=24

90-24=66

66÷4=16.5

Answer Link

Otras preguntas

Risk magnitude is: a) another term similar in meaning to the likelihood of risk b) no longer relevant to modern risk management practices (since 2004) c) the le

Which of the following refers to a form of government payment to a producer? a) Currency control b) Import quota c) Subsidy d) VER Export financing

What is 21 766+654+766+566

Because scientific progress is typically made slowly, Dyer (2022) argues:a) It is better to use incomplete evidence than to use none, so practitioners should us

In the late 19th and early 20th centuries, how did colonialism and imperialism affect both China and Vietnam?

A Yanbu job shop has four departments-machining (M), dipping in a chemical bath (D), finishing (F), and plating (P) assigned to four work areas. The operations

Current Test: Brakes 9.) Which of these is the recommended procedure to tighten the axle nut when replacing a sealed wheel bearing assembly on a front-wheel dri

Rock and roll was less divided along racial lines as it was genders national origins social classes / income age groups

Submit a set of psychoeducational materials for the family featured in your case followed by an explanatory narrative. Psychoeducational Material Set: Your set

Codons Which amino acids does this mRNA strand code for? *You must spell out the entire name of the amino acid* 5'CCGGAUGUCCGUAUAACGGC3'