Thatkidriyahh Thatkidriyahh
  • 22-05-2020
  • Mathematics
contestada

Can somebody plz help me

Can somebody plz help me class=

Respuesta :

Аноним Аноним
  • 22-05-2020

Choice 3Step-by-step explanation:

3x^2-19x-14

Answer Link
thewizyadig
thewizyadig thewizyadig
  • 23-05-2020
The answer of this solution is C
Answer Link

Otras preguntas

Does “actions speak louder than words” refer to leadership, mentoring, or teaching by example?
a solution of 0.10 hydrochloric acid, HCL is a better conductor of electricity than 0.10 M acetic acid, CH3COOH. sketch the ions and molecules in both solutions
the surface of water connect like a sort of sort of skin due to property of liquids called
write a sentence using the words limiting factor and carrying capacity
In hexagonal writing and analysis of literary devices explores
Make a phrase with each of them for me please 1) Beneficial 2) benefited 3) Breath 4) Brilliant Thank you so much ! Please , no grammars mistakes
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
What does the term human rights mean
what number should be added to the expression to turn it into a perfect square trinomial x^2+2x
A department store purchases a dress for $80. To sell the dress to customers, the price is marked up by 19%. You hand the clerk $110. How much change will you