helenirby1964 helenirby1964

22-05-2020
Chemistry

contestada

4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Please

Respuesta :

FortniteforLifeooof FortniteforLifeooof

22-05-2020

Answer:

AUUUAAAHAHYAGHY

Explanation:

Answer Link

Otras preguntas

Kevin is selling 7 identical alternators and a car wheel for scrap. He knows the wheel weighs 19.5 pounds. He puts all the items on a scale at the scrap yard an

O ônibus espacial,preso sobre o avião está em movimento ou repouso?

can someone help me with this question thanks

In a corn field, 2 out of 20 pieces of corn were rotten. Based on this information, how many pieces of rotten corn could be expected in a field of 260 pieces of

plz help me I don't understand

What kinds of jobs will be available for you when the time comes? It’s hard to know exactly, but this is a good time for you to begin thinking about careers. W

What does the graph tell you about the value of n f(x)=a(x+k)^(1/n)+c A n is a negative odd integer B n is a positive even integer C n is a negative even intege

Why was the shoshones willing to take a risk to assist Lewis and Clark

In three to five sentences, explain the purpose of including in-text citations in informative/explanatory writing.

Given that g(x)=x^2-4x-5, find (g*g) (-2)