joyiabell123 joyiabell123

25-04-2020
Biology

contestada

What two substances give the sponge support?

Respuesta :

00059269 00059269

25-04-2020

Answer:the calciferous and siliceous spicules

Explanation:

Answer Link

Otras preguntas

PLEASE ANSWER QUICK!! The equation and the tables represent two different functions. Use the equation b=4a-5 and the table to answer the questions. This table

Simplify the following (7x^4)^2

The table shows the heights of players in a basketball team.

HELP PLSSS Select the correct answer. Which sentence best matches a restaurant or a café? A. Il n’y a pas une grande variété d’aliments. B. On doit payer avan

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT

During exhalation, air moves from the a. bronchus to the bronchioles b. bronchus to the alveoli c. bronchioles to the alveoli d. bronchioles to the bronchi

Explain the difference between birth rate mortality rate. Describe how population growth occurs in the US (s curve or j curve)

Please I’m desperate Ty :))

What are examples of cocurricular education? Select three options. A CTSO for students taking marketing classes a school sports team a club providing hands-on l

The angles opposite the congruent sides of an isosceles triangle are congruent. Find the value of x I. The triangle show all your work. The triangle is in the i