xoxonene xoxonene
  • 24-04-2020
  • Mathematics
contestada

Can someone plz help me with this I’m not understanding this
(The answer is not b)

Can someone plz help me with this Im not understanding this The answer is not b class=

Respuesta :

PollyP52 PollyP52
  • 24-04-2020

Answer:

D.  m = 20 , n = 10.

Step-by-step explanation:

The sine of 60 is √3/2, so

sin 60 =  10√3 / m = √3/2

√3 m = 20 √3

Divide both sides by √3:

m = 20.

cos 60 = 1/2 =  n / 20

2n = 20

so n = 10.

Answer Link

Otras preguntas

4. When a turbine spins, it generates electrical energy and that is where it gets its name from.
Geologists collected some rock samples. Of the 12,000 grams of ore they collected, about 600 grams contain a valuable mineral What is the concentration of the m
Hii I would love if anyone would be able to give me the answer to this <3
What is the sum of all integers which are not divisible by 5 or 9 between 1 and 100?​
Can somebody help me :
how much power is needed to lift a box with a force of 780 newtons over a distance of 2 meters in 45 seconds
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
Skin grafts between identical twins are more successful than grafts between more unrelated individuals. Why
How do you break down an element?
Janet is playing a game in which she interacts with an environment to solve a puzzle and to meet new characters. She really enjoys this game because there are n