luvxmimi luvxmimi

23-04-2020
Biology

contestada

Create the complement of the following DNA strand. TACCCATTACGCGGCAAGCGUAATTAC

Respuesta :

Аноним Аноним

23-04-2020

Answer:

This is the mRNA strand

Explanation:

AUGGGUAAUGCGCCUUCGCAUUAAUG

Answer Link

StephanyNo StephanyNo

23-04-2020

AUGGGUAAUGCGCCGUUCGCAUUAAUG

Answer Link

Otras preguntas

Ricardo is factoring the polynomial, which has four terms. 5x3 + 20x2 + 2x + 8 5x2(x + 4) + 2(x + 4) Which is the completely factored form of his polynomial?

select the graph of the solution set that would represent the following expression. (x-2)=5(x+1)

Which is the simplified form of the expression (6 to the power of -2 times 6 to the power of 5) to the -3rd power? A)6 to the 30th power B)1 over (6 to the powe

Jenna uses the Fermi process to estimate the number of stickers it would take to cover her bedroom floor. Both her stickers and her floor are rectangular in sha

PLZ HELP ME!!!!!!!!!!!!!!

All of the following are correctly paired with their phase of the business cycle EXCEPT __________. A. high level of employment: peak phase B. slowdown of bu

13. Simplify this expression: 19-(-8) - (-14) = ?

how do I make my copper wire produce a magnetic field around it?

The center of the abdominal regions is the blank region

what is the other binomial?