andyenfusse andyenfusse
  • 27-03-2020
  • English
contestada

Slow is to quick as always is to

Respuesta :

huashih9 huashih9
  • 27-03-2020

Answer:never

Explanation:

Answer Link
mguti024
mguti024 mguti024
  • 27-03-2020
Never is the answer
Answer Link

Otras preguntas

The graph shows the number of laps kailee ran around a track over a given number of minutes.(a) What is the slope of the line? Use the slope formula and show yo
What technique did Renaissance artists use to transfer images for large-scale paintings? A. They made detailed sketches called cartoons. B. They wrote notes a
DNA tacaggtacccgaacccaattta
Goldie was given 2 1/3 cups of food. She ate 3/4 of her meal. If there were 10 cups of food in the bag to start with, how much food did she have left?
according to Call Of the Wild as new lead dog buck improved the solitary of the team. what does this mean
Create a scenario that leads to an inequality of the form ax + b > c. Just list some Ideas you don't have to make the word problem I was just lost.
Pls help me jfkdbsks
The grocery store sells kumquats for $5.00 a pound and Asian pears for $3.25 a pound. Write an equation in standard form for the weights of kumquats k and Asian
What is the probability that a 60% free throw shooter will make three free throws in a row?
Cells produce ATP both aerobically and anaerobically. One process is an integral part of aerobic respiration that produces the majority of ATP molecules is A) g