eiearly10 eiearly10
  • 25-03-2020
  • Biology
contestada

CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Respuesta :

annabellefarmer
annabellefarmer annabellefarmer
  • 25-03-2020
A because like what even is this??
Answer Link

Otras preguntas

The planets that reside in the inner region of the solar system are called ______ (A. giants B.Ice Cap C.terrestral) planets. These planets share certain chara
When presenting research, it is imperative to inform the reader of ____________. Question 6 options: the facts the details your personal opinions Both A and B
The Republic of Turkey became a country in 1923. Which of the following is one of the changes implemented by Mustafa Kemal, Turkey's first president?
According to horney, the feeling of being isolated and helpless in a potentially hostile world is called
Find all real values of x such that ƒ(x) = 0 for ƒ(x) = 42 - 6x
I WILL MARK BRAINLIEST 1. Energy changes occur as a.heat transfer b.work c.power d.a combination of heat transfer and work 2. How does heat energy spontaneousl
The explicit rule for a sequence is an=7(−4)n−1 . What is the recursive rule for the sequence? an=−4(an−1),a1=7 an=−7(an−1),a1=4 an=−7(an+1),a1=4
How does the United States Catholic Catechism for Adults (USCCA) define the Incarnation?
Choose the system of equations that matches the following graph: picture of coordinate plane with line y equals 1 half x and line y equals 7 sixths x plus 4. Th
Which is an english derivative from the latin word for "seek"?