rgarcia160 rgarcia160
  • 24-03-2020
  • Mathematics
contestada

4/5 divided by 7/6 divided by -3/9

Respuesta :

melahinayah1 melahinayah1
  • 06-04-2020

Answer: -72/35

Step-by-step explanation:

Answer Link

Otras preguntas

How the growth of cities affected agriculture in Mesopotamian society.
help pleasethere us a picture A. 2B. 3C. 8D. 10​
Why did people domesticate plants? 1. They were more flavorful 2. They were a reliable food supply 3. They made it easier to migrate 4. They wanted to live in
How did disease affect the civil war troops?
In which sentence is the adverb clause punctuated correctly? A. After he played and won the soccer game, he went to eat dinner. B. He went to eat dinner, after
Answer the following question: 7/2h - 3 (5h - 7/2)
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
which sentence is exclamation?a, would you take a look?b, you're going the wrong way!c, turn the corner slowly.d, the house is white and brick.​
Help help help math math
Imagine that you are managing a large wildlife preserve that was formerly a cattle ranch. You know from historical accounts that wild sheep used to live there,