zepedamercedez zepedamercedez

26-01-2020
English

contestada

3. Using questions is often not a good idea.
a. True
b. False

Respuesta :

jessica0111 jessica0111

26-01-2020

Answer:

I would say true (but it's false)

Explanation:

I corrected my answer

Answer Link

alonna2000 alonna2000

26-01-2020

I think it’s false, but I could be wrong.

Answer Link

Otras preguntas

help please help ghelp

Five times a complement of an angle exceeds twice its supplement by 9. Find the angle

John O'Sullivan was which of the following? A) a lawyer B) an orator C) a politician D) a journalist

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid

Read the following excerpt and answer the question. “Where there are pistol shots, there are men. Where there are men, there is food,” he thought. "But what kin

Determine which of the ordered pairs (0,0) and (3,1) is a solution of the below system of equations. X+y=4X-y=0

What effects do catalysts have on chemical reactions? 1.Catalysts slow down chemical reactions 2.Catalysts reverse chemical reactions 3.Catalysts speed up chemi

Which function is increasing and has a domain of (1,∞ )

What is a good thesis for Romeo and Juliet? Would debating whether or not Romeo and Juliet is pedophilia?

An online survey company wants to know if customer age is important in deciding to subscribe. The company has gathered a random sample of 1000 people from the p