briannaharries09
briannaharries09 briannaharries09
  • 25-11-2019
  • Mathematics
contestada

Is it ever possible that sin (A+B)=⁡ (A+B)= sin⁡ A+sin⁡ B?

If so, explain how. If not, explain why not.

Respuesta :

Аноним Аноним
  • 25-11-2019

Although this isn't obviously a general rule, you can choose the special case [tex]A=B=0[/tex], and the expression will become true:

[tex]\sin(0+0)=0+0=\sin(0)+\sin(0)[/tex]

because all these expressions return 0.

Answer Link

Otras preguntas

What spheres are affected by pesticides? Is the atmosphere, geosphere, hydrosphere, and biosphere affected by pesticides?
solve for the right triangle
How does Lyddie feel about Luke’s proposal.
Someone help with this I’m gonna fail !
2. You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’. template DNA 3’ CCTACGGTTCGTACCCCGTA
48 is what pecent of 64
can someone explain how to do this for me?
Lord of the Flies: Golding spends a lot of time describing the island. Knowing that authors are intentional with their writing, explain how the figurative langu
Does the rule y = −2 · 2x represent a linear or an exponential function? Exponential
When a calcium atom becomes an ion, it gains one proton Loses one electron. gains two electrons. Loses two electrons.