Haileyd1110 Haileyd1110
  • 22-11-2019
  • Mathematics
contestada

0.00462962962 as a fraction?

Respuesta :

407kailani
407kailani 407kailani
  • 25-11-2019

Answer:

462962962/100000000000

Answer Link

Otras preguntas

which of the following statements most accurately describes the effects caused by binding of the neurotransmitter (green dots) to the structure labeled C? a. Th
What is the vapor pressure of water at 750C?
Three differences and one similarity between Shakespeare world and our own
Compare and contrast immune tolerance with licensing
What does the equation -355-n=-957 what does n equal?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
can organisms naturally repair a mutation?
what was the key philosophy held by founding fathers
How can one concentrate in studies ?
the primary organic source of energy for living things are