amerastaejia amerastaejia
  • 22-10-2019
  • Mathematics
contestada

For every 5 mile that Sira jogs, she walks mile.
What unit rate gives the number of miles Sira jogs for
every mile she walks?
!

Respuesta :

scholarszn
scholarszn scholarszn
  • 24-10-2019

Answer:

5n=x?

Step-by-step explanation:

Answer Link

Otras preguntas

The spread of ideas during the Renaissance was MOST affected by. A) luthers religious conversion. B) the support of the Catho
PLEASE HELP ME AASSAPP
Who is Christina LeConte
what's the possibility of choosing a spade in a deck of 52 cards?
One +4 equals five, 2+5 = 12, 3+6 = 21, what does 8+ 11 equal
What are the adaptive immune responses induced following acute and chronic infection with HIV?
6. Why is crossing over, or recombination, in meiosis a genetic advantage for a n organism? Why is crossing over an advantage for a geneticist
The chorionic villi of the placenta develop a series of capillaries that are immersed in lacunae of the mother's blood for exchange into the embryo's blood duri
Which name does the monk who travels to the west not use
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC