Aaasia Aaasia
  • 22-05-2019
  • English
contestada

What are important events in fahrenheit 451

Respuesta :

michaelcarter michaelcarter
  • 22-05-2019

Answer:

c

Explanation:

cause i like girls

Answer Link

Otras preguntas

what is the mean of
If you saw this strand of DNA how many base pairs would be in thestrand?aagcttctgaatcagttcgaagacttagtc​
In a democratic society is propaganda ethical and 'fair'?
"Someone who invests resources (such as time, money and skill) to create and build an organization that offers various types of benefits to entice others to joi
The maps show the recent past and projected future makeup of the forests of the eastern United States. Which tree types are expected to replace maples, beeches,
2. (3pts) Describe the lysing process that occurs when we perform the ""slow freeze-quick thaw"" procedure for preparing a crude extract of rGFP?
The shadow of a pendulum cast on a flat board moves on a straight line. By placing the x-axis on the straight line with the origin at the middle of the total pa
When the Arizona grocery store chain, Smitty’s, told Associated Grocers (AG) to give them a bigger price discount or they would open their own warehouse and dis
Plaintiff sued a National Football League team, alleging that she had been sexually assaulted by several team members in a hotel room after a game. Team offered
The required return on equity for an all-equity firm is 10.0 percent. They are considering a change in capital structure to a debt-to-equity ratio of 1/2, the t