danielahchf danielahchf

26-04-2019
Mathematics

contestada

Which of the following quadratic functions are in standard form?
(Picture attached)

Which of the following quadratic functions are in standard form Picture attached class=

Respuesta :

26-04-2019

E and F

The standard form for a quadratic function is f(x) = ax^2 + bx + c.

E follows this pattern. a = -2; b = -8; c = 3

F also follows this pattern. a = 1/2; b = -2; c = 0

Answer Link

Otras preguntas

The term racial unconscious means that

Which one of the following statements expresses a true proportion? A. 2 : 3 = 3 : 2 B. 3 : 5 = 12 : 20 C. 42 : 7 = 6 : 2 D. 14 : 6 = 28 : 18

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Lee used her computer for 60 minutes on Friday. On Saturday, she used her computer for 150% of the number of minutes she used it on Friday. What was the number

If you drink a soda with sugar, what happens to your blood glucagon levels?

Find the commission on a $750.00 sale if the commission is 24%. $166.00 $180.00 $131.25 $201.00

The number of cells in an average-sized adult human is on the order of 10^14 cells. Use this information, and the estimate that the length of DNA contained in e

what the decimal of 2 1/4

specificity is important to fitness program because it

need help ASAP! A state park is designed in a circular pattern as shown. Mia runs along the circular path from the tennis courts to the petting zoo. How far doe