3opemaster 3opemaster
  • 24-10-2018
  • Mathematics
contestada

Plsssssssssss help me

Plsssssssssss help me class=

Respuesta :

Gyzmo
Gyzmo Gyzmo
  • 24-10-2018

The measure of angle m∠BAC≅180°-m∠DAB≅55°.

The sum of the angles in a triangle is 180°.

180°≅55°+30°+m∠ABC

180°-55°-30°≅m∠ABC

m∠ABC≅95°

Answer Link

Otras preguntas

Which situation CANNOT be represented by this equation? -1\4x + 14 = 8 A) A hot-air balloon has a 14-foot diameter that each 1\4 of an hour gets steadily smal
Suggest a reason why food labels provide information about the energy released by the food?
Sharp pain is transmitted through which type of nerve fibers?
Which of the following statements about tuberculosis is FALSE? A.It usually affects the digestive tract. B. It responds to a long course of antibiotic treatment
Suppose a pizza must fit into a box with a base that is 12 inches wide. You can use the quadratic function a=(Pi)r^2 to find the area of a pizza in terms of its
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
what are the 3 care instructions for future life on earth
why are cancer causing factors in lifestyle and environment difficult to identify
suppose you were to grind the up and homogenate a pancreas. Do you think it would be possible to isolate insulin from this homogenate?
What is the answer to 8xsquared-24x