kendallknight80 kendallknight80

24-07-2018
Mathematics

contestada

What is the volume in cubic centimeters of the cylinder?

What is the volume in cubic centimeters of the cylinder class=

Respuesta :

iamsriracha iamsriracha

24-07-2018

A cone is 1/3 the volume of a cylinder, so if the cone is 258.9, we should multiply by 3 is get the cylinder's volume:

258.9 times 3 = 776.7

Answer Link

Otras preguntas

Emily buys 4pens for £1 how much would 7 pens cost ?

State two biological reasons why you consider that the loss of biodiversity matters.

Joe made 15 points in a basketball game, 3 points are given for a long shot, 2 points given for a field goal, and 1 point is given for a free throw. In how many

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

While the signalman is describing the actions of the person he sees by the mouth of the tunnel, the narrator says in his mind. "for God's sake clear the way!" w

Whose image will replace Andrew Jackson on the U.S. 20$ bill

An air force plane flew to Jakarta and back. On the trip there it flew 480 km/h and on the return trip it went 288 km/h. How long did the trip there take if the

Which department did the US government create immediately after the 9/11 terrorist attacks

A number tripled and tripled again is 729 what is the number

Which naval battle forced the German high seas fleet to its harbor and this helped turn the war in favor of the allies