ck424242 ck424242

26-02-2024
Biology

contestada

fill in with the mRNA strand, then translate to the amino acid sequence using this chart. Remember to always start with the start condon, and end with the stop condon. (Condon = 3 rucleotides) DNA: ATGTTTGCATACCAAGGCTAAATTTTC TRANSCRIPTION: mRNA: pROTEIN (AMINO ACID SEQUENCE): Translation

Respuesta :

Otras preguntas

at a currency exchange,8 u.s dollars can be exchanged for 6 euros. how many euros will you receive for 1 u.s dollar

How do I do it this

If a researcher used U.S. census data to examine the relationship between women's employment and childbearing, this would be an example of a?

4 times a number increased by 3 is between negative 5 and 15

Can someone help me with this? (WILL GIVE BRAINLIEST)

(9,3), (9,-1) find the slope of the line that passes through the points

Y is. Eight more than X

The American Bankers Association is an example of a A. labor union. B. public-interest group. C. trade association. D. single-interest group.

Name one benefit and one limitation of comparative investigations

Passage (CAG_ELA 9_Ronald Reagan's Inaugural Address) Read Ronald Reagan's Inaugural Address below and answer the following questions analyzing this piece of in