kevinmedina0902 kevinmedina0902
  • 22-01-2023
  • Biology
contestada

DNA Never leaves the Nucleus of the cell. This is why you need RNA. In Transcription, DNA is
transcribed into a strand of RNA.
DNA has Adenine, Thymine, Cytosine, Guanine
RNA has Adenine, Uracil, Cytosine, Guanine
Transcription of DNA to RNA
ATGCCTAAGCCGTGTCCGAT

Respuesta :

Otras preguntas

how do I solve this problem? mars rotates on its axis at the rate of . 2552 rad/hr how many hours are in a martian day?
true or false for the best control of both the accelerator and brake pedals rest the heel of your foot on the floor??
What was Jefferson’s official position regarding the Napoleonic Wars?
Please help!! There's a picture.
Why did Daniel shays rebel against the government
The highest point in California is Mount Whitney at 14,494 feet above sea level. The lowest point is the Death Valley at 282 feet below sea level (-282). What i
Calculate the surface area of a cube with side measurement of 3.2 inches?
What was Jefferson’s official position regarding the Napoleonic Wars?
A _______________________ parking space is set at an angle of 90 degrees to the curb. A. perpendicular B. parallel C. angled D. small
How much times does 7 go into 17?